ID: 1107479167_1107479173

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1107479167 1107479173
Species Human (GRCh38) Human (GRCh38)
Location 13:40771219-40771241 13:40771235-40771257
Sequence CCGGCCTGGCGCCTTCCTCCCCC CTCCCCCTTTGCGCTCCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 78, 4: 722} {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!