ID: 1107483633_1107483641

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1107483633 1107483641
Species Human (GRCh38) Human (GRCh38)
Location 13:40805688-40805710 13:40805725-40805747
Sequence CCTAGAGGTAACTATTCTTACCC CCTTCAAGTGTACCTGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 159} {0: 1, 1: 0, 2: 1, 3: 9, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!