|
Left Crispr |
Right Crispr |
| Crispr ID |
1107498534 |
1107498538 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:40953135-40953157
|
13:40953160-40953182
|
| Sequence |
CCCAGCTAATTCTGTATTTTCAG |
GAGACGGGATTTCTCCATGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 418, 2: 9235, 3: 22516, 4: 14353} |
{0: 319, 1: 9924, 2: 65943, 3: 151892, 4: 137847} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|