|
Left Crispr |
Right Crispr |
Crispr ID |
1107498534 |
1107498540 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:40953135-40953157
|
13:40953169-40953191
|
Sequence |
CCCAGCTAATTCTGTATTTTCAG |
TTTCTCCATGTTGGTCAGGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 6, 1: 418, 2: 9235, 3: 22516, 4: 14353} |
{0: 18586, 1: 36319, 2: 134688, 3: 174060, 4: 144372} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|