ID: 1107510980_1107510989

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1107510980 1107510989
Species Human (GRCh38) Human (GRCh38)
Location 13:41084700-41084722 13:41084742-41084764
Sequence CCCTCTCCATGACCACTATGGGG TGTTAACACTGGGTATATATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154} {0: 1, 1: 0, 2: 0, 3: 20, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!