ID: 1107510983_1107510988

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1107510983 1107510988
Species Human (GRCh38) Human (GRCh38)
Location 13:41084706-41084728 13:41084741-41084763
Sequence CCATGACCACTATGGGGTTTTCC ATGTTAACACTGGGTATATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104} {0: 1, 1: 0, 2: 2, 3: 20, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!