ID: 1107548315_1107548325

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1107548315 1107548325
Species Human (GRCh38) Human (GRCh38)
Location 13:41454342-41454364 13:41454376-41454398
Sequence CCTTCCCTGGCTATTACGATACA GGCGGGCGACGCTCGCGACGCGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 6, 3: 34, 4: 154} {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!