ID: 1107556349_1107556358

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1107556349 1107556358
Species Human (GRCh38) Human (GRCh38)
Location 13:41519543-41519565 13:41519583-41519605
Sequence CCTTCCGCGTTCTGCCTTTGCAT CACCTTGACTGTAGAAGGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!