ID: 1107563240_1107563245

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1107563240 1107563245
Species Human (GRCh38) Human (GRCh38)
Location 13:41576573-41576595 13:41576594-41576616
Sequence CCATTATAGATATGCTGAACTTG TGTGTCCTGGGGGAGAGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 182} {0: 1, 1: 0, 2: 0, 3: 48, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!