ID: 1107577112_1107577113

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1107577112 1107577113
Species Human (GRCh38) Human (GRCh38)
Location 13:41737460-41737482 13:41737475-41737497
Sequence CCTATCTATAAAAGACAAATTCA CAAATTCACTTTGCCATATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 637} {0: 1, 1: 0, 2: 0, 3: 37, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!