ID: 1107595692_1107595716

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1107595692 1107595716
Species Human (GRCh38) Human (GRCh38)
Location 13:41960981-41961003 13:41961033-41961055
Sequence CCGGGTGCCCCGAGGAGTAGAAG CGGGGACGGCGAGGGGGCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107} {0: 1, 1: 0, 2: 2, 3: 43, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!