ID: 1107608475_1107608477

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1107608475 1107608477
Species Human (GRCh38) Human (GRCh38)
Location 13:42087084-42087106 13:42087111-42087133
Sequence CCTCAGAACAGAGTAGGCACAAC CTTGAAGCTCATACAGAACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 116} {0: 1, 1: 0, 2: 1, 3: 9, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!