ID: 1107642097_1107642108

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1107642097 1107642108
Species Human (GRCh38) Human (GRCh38)
Location 13:42454002-42454024 13:42454035-42454057
Sequence CCCTCCACCTCCTGGATTCAAGG CCTCGGCCTCCTGAGTAGCTGGG
Strand - +
Off-target summary No data {0: 1523, 1: 101544, 2: 207650, 3: 241638, 4: 162906}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!