|
Left Crispr |
Right Crispr |
| Crispr ID |
1107688641 |
1107688643 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:42929526-42929548
|
13:42929564-42929586
|
| Sequence |
CCTATGGTATGCATTTTCCTTTG |
AACCCAACTTGTTCAACTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 2, 2: 0, 3: 32, 4: 254} |
{0: 5, 1: 17, 2: 38, 3: 44, 4: 106} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|