ID: 1107694259_1107694264

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1107694259 1107694264
Species Human (GRCh38) Human (GRCh38)
Location 13:42985161-42985183 13:42985192-42985214
Sequence CCAAAGAAAATCATATTTATTCT CATTGCAATGGGAATACAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 90, 4: 838} {0: 1, 1: 2, 2: 6, 3: 15, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!