ID: 1107727653_1107727657

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1107727653 1107727657
Species Human (GRCh38) Human (GRCh38)
Location 13:43316109-43316131 13:43316133-43316155
Sequence CCTCCACCAGGCTCAAGGGACTC TAGCACTAAGCAAGAAGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 93, 4: 906} {0: 1, 1: 0, 2: 0, 3: 19, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!