ID: 1107735088_1107735093

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1107735088 1107735093
Species Human (GRCh38) Human (GRCh38)
Location 13:43391016-43391038 13:43391065-43391087
Sequence CCGTTTCTTATGATATTGTTCAA TCCCCACAGCTCCCCCAGAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 514} {0: 1, 1: 0, 2: 0, 3: 26, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!