|
Left Crispr |
Right Crispr |
| Crispr ID |
1107753947 |
1107753960 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:43599324-43599346
|
13:43599367-43599389
|
| Sequence |
CCCACCATCGCTGCACTCTCCCT |
AGGGAGAGTGCAGTGATAGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 25, 3: 81, 4: 349} |
{0: 3, 1: 17, 2: 46, 3: 132, 4: 383} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|