ID: 1107759702_1107759715

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1107759702 1107759715
Species Human (GRCh38) Human (GRCh38)
Location 13:43664952-43664974 13:43664985-43665007
Sequence CCATAGGACAGCCTGCAGCCCCA CACAAAATCTCCTGCGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 231} {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!