ID: 1107888443_1107888453

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1107888443 1107888453
Species Human (GRCh38) Human (GRCh38)
Location 13:44893823-44893845 13:44893870-44893892
Sequence CCCAGGCAGAAGGAGGACACCCG GTCTACGTTGCAGGATTGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!