ID: 1107888444_1107888451

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1107888444 1107888451
Species Human (GRCh38) Human (GRCh38)
Location 13:44893824-44893846 13:44893861-44893883
Sequence CCAGGCAGAAGGAGGACACCCGG CCCTCGGATGTCTACGTTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!