ID: 1107889940_1107889946

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1107889940 1107889946
Species Human (GRCh38) Human (GRCh38)
Location 13:44905384-44905406 13:44905412-44905434
Sequence CCAAAATGAGAGGGAGGCTGGAT CGAGTTATGTGGGGAAGTACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!