ID: 1107895292_1107895302

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1107895292 1107895302
Species Human (GRCh38) Human (GRCh38)
Location 13:44956017-44956039 13:44956052-44956074
Sequence CCTGTAGTCCCAGCTACTCGGGA AGAATGGTGTGAACCCCAGGGGG
Strand - +
Off-target summary {0: 54379, 1: 173656, 2: 264604, 3: 194654, 4: 115454} {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!