ID: 1107962867_1107962877

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1107962867 1107962877
Species Human (GRCh38) Human (GRCh38)
Location 13:45574615-45574637 13:45574660-45574682
Sequence CCCCATCTACATAGAGGGAGTAG CTGTGCTTGTTGGAGTTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 135} {0: 1, 1: 1, 2: 2, 3: 42, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!