|
Left Crispr |
Right Crispr |
| Crispr ID |
1107966226 |
1107966228 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:45600744-45600766
|
13:45600796-45600818
|
| Sequence |
CCGTTGGTGGACACTTAGGTTGA |
TATGATAAACATACAGTTGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 22, 1: 297, 2: 1035, 3: 2493, 4: 3783} |
{0: 1, 1: 1, 2: 20, 3: 115, 4: 379} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|