ID: 1107968099_1107968107

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1107968099 1107968107
Species Human (GRCh38) Human (GRCh38)
Location 13:45615426-45615448 13:45615465-45615487
Sequence CCCAACAACGGCCTTCACAATGG AGCAGATGTCAGAAAGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62} {0: 1, 1: 0, 2: 2, 3: 34, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!