ID: 1107987484_1107987492

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1107987484 1107987492
Species Human (GRCh38) Human (GRCh38)
Location 13:45787748-45787770 13:45787795-45787817
Sequence CCCAGTGCACGGTGGATATTAGC TGTGCTTTAGGGAGCTACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50} {0: 1, 1: 0, 2: 0, 3: 25, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!