ID: 1107988349_1107988352

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1107988349 1107988352
Species Human (GRCh38) Human (GRCh38)
Location 13:45795381-45795403 13:45795420-45795442
Sequence CCTGCTAATCTGTGACACCAGGT AGAGTTTCCCAGCACTCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 11, 4: 122} {0: 1, 1: 1, 2: 0, 3: 19, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!