ID: 1107992022_1107992023

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1107992022 1107992023
Species Human (GRCh38) Human (GRCh38)
Location 13:45827011-45827033 13:45827042-45827064
Sequence CCTTTTTTCTTCATGGCTAACAG TTTCATTCATGTCAGCTAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 330} {0: 1, 1: 0, 2: 0, 3: 17, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!