ID: 1107994255_1107994257

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1107994255 1107994257
Species Human (GRCh38) Human (GRCh38)
Location 13:45845429-45845451 13:45845446-45845468
Sequence CCATCACGGTGTTTCAGATGGCC ATGGCCACAGTTATAAAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 83} {0: 1, 1: 6, 2: 24, 3: 47, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!