ID: 1108007179_1108007184

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1108007179 1108007184
Species Human (GRCh38) Human (GRCh38)
Location 13:45961056-45961078 13:45961098-45961120
Sequence CCTGGGCTCTATCACCAGATTTG GTTGGACTAGAATACCTTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 139} {0: 1, 1: 0, 2: 2, 3: 17, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!