ID: 1108033075_1108033077

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1108033075 1108033077
Species Human (GRCh38) Human (GRCh38)
Location 13:46257150-46257172 13:46257164-46257186
Sequence CCATGAGTCAAGGAATGAGGCAG ATGAGGCAGCTTGAAAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 58, 4: 400} {0: 1, 1: 0, 2: 0, 3: 15, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!