ID: 1108044262_1108044266

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1108044262 1108044266
Species Human (GRCh38) Human (GRCh38)
Location 13:46368033-46368055 13:46368073-46368095
Sequence CCAACTTGCCTTCATAGCCACTG CCCAGACTCTTGCTTTATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 342} {0: 1, 1: 0, 2: 2, 3: 12, 4: 151}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
17 13:46368033-46368055 CCAACTTGCCTTCATAGCCACTG - 13:46368073-46368095 CCCAGACTCTTGCTTTATGTTGG +