ID: 1108065115_1108065126

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1108065115 1108065126
Species Human (GRCh38) Human (GRCh38)
Location 13:46569589-46569611 13:46569636-46569658
Sequence CCCAGACCCCTCCTGTGGCTCTC CTGCCTAGCAGCAGATCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 356} {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!