ID: 1108067652_1108067654

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1108067652 1108067654
Species Human (GRCh38) Human (GRCh38)
Location 13:46595019-46595041 13:46595058-46595080
Sequence CCTAGCTTCTTCTGAGTTTATAG AATACCATGATGATCATTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 374} {0: 1, 1: 1, 2: 0, 3: 13, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!