ID: 1108067652_1108067655

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1108067652 1108067655
Species Human (GRCh38) Human (GRCh38)
Location 13:46595019-46595041 13:46595059-46595081
Sequence CCTAGCTTCTTCTGAGTTTATAG ATACCATGATGATCATTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 374} {0: 1, 1: 0, 2: 0, 3: 18, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!