ID: 1108072919_1108072925

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1108072919 1108072925
Species Human (GRCh38) Human (GRCh38)
Location 13:46647930-46647952 13:46647949-46647971
Sequence CCGGTTTTGTGGAAGACAGCTTT CTTTTCCCCAGACCGGGGTGGGG
Strand - +
Off-target summary {0: 2, 1: 112, 2: 452, 3: 737, 4: 1147} {0: 1, 1: 0, 2: 7, 3: 72, 4: 530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!