|
Left Crispr |
Right Crispr |
| Crispr ID |
1108084569 |
1108084572 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:46772653-46772675
|
13:46772672-46772694
|
| Sequence |
CCATTCAGCTCCTGCTTATAAGT |
AAGTGAGAGCATGTGGTGTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 27, 3: 113, 4: 300} |
{0: 23, 1: 802, 2: 7703, 3: 15866, 4: 20410} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|