ID: 1108086199_1108086202

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1108086199 1108086202
Species Human (GRCh38) Human (GRCh38)
Location 13:46796321-46796343 13:46796353-46796375
Sequence CCATCTGCAAAATGGGTATACAG TCAATTTGATAGGGTTGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 83, 4: 575} {0: 1, 1: 0, 2: 1, 3: 10, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!