ID: 1108086919_1108086926

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1108086919 1108086926
Species Human (GRCh38) Human (GRCh38)
Location 13:46803467-46803489 13:46803518-46803540
Sequence CCTGGAGATAGTGTCAGAACCCA TTGACCTACCTGCTTCAAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 58, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!