ID: 1108089181_1108089185

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1108089181 1108089185
Species Human (GRCh38) Human (GRCh38)
Location 13:46828946-46828968 13:46828981-46829003
Sequence CCTTCAGGGAAATTGAACTCAAA TTGTTCTTCAGGAAGCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 428, 4: 15982} {0: 1, 1: 0, 2: 2, 3: 50, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!