ID: 1108120464_1108120466

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1108120464 1108120466
Species Human (GRCh38) Human (GRCh38)
Location 13:47180422-47180444 13:47180460-47180482
Sequence CCATAGGGTGACTATAGTTAACA TTTCCAAAAAGCCAGAAAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 13, 3: 99, 4: 994}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!