ID: 1108201064_1108201070

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1108201064 1108201070
Species Human (GRCh38) Human (GRCh38)
Location 13:48043683-48043705 13:48043716-48043738
Sequence CCTCATTCTTCAGTCCTCTTTTT GCCTCTGTAGGGATTTGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 61, 4: 761} {0: 1, 1: 0, 2: 2, 3: 19, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!