ID: 1108201888_1108201897

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1108201888 1108201897
Species Human (GRCh38) Human (GRCh38)
Location 13:48052533-48052555 13:48052582-48052604
Sequence CCAAGAGAGGTAAACCAGACCAC ATGAACTGCCTTGAGGGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110} {0: 1, 1: 0, 2: 0, 3: 29, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!