ID: 1108223492_1108223499

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1108223492 1108223499
Species Human (GRCh38) Human (GRCh38)
Location 13:48263405-48263427 13:48263423-48263445
Sequence CCCTTTGAACCCTTGTGCCATGC CATGCTGGAAACTGTGGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117} {0: 1, 1: 0, 2: 4, 3: 25, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!