ID: 1108272044_1108272051

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1108272044 1108272051
Species Human (GRCh38) Human (GRCh38)
Location 13:48771218-48771240 13:48771270-48771292
Sequence CCACAGAAAATCACATACCTGAA TGGCTGACCTGACTTCCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 31, 4: 322} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!