|
Left Crispr |
Right Crispr |
| Crispr ID |
1108293550 |
1108293555 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:48988187-48988209
|
13:48988238-48988260
|
| Sequence |
CCACACAGTAATAGTGGGAGACT |
AACGAGACAGGAAATTAACAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 72, 1: 1472, 2: 7459, 3: 3442, 4: 1572} |
{0: 6, 1: 379, 2: 2982, 3: 4875, 4: 3023} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|