ID: 1108307314_1108307319

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1108307314 1108307319
Species Human (GRCh38) Human (GRCh38)
Location 13:49151111-49151133 13:49151160-49151182
Sequence CCATTTAAATACAATGAAATTTC TGTCTAATGCTGAGAGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 732} {0: 1, 1: 1, 2: 17, 3: 32, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!