ID: 1108319028_1108319031

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1108319028 1108319031
Species Human (GRCh38) Human (GRCh38)
Location 13:49269131-49269153 13:49269159-49269181
Sequence CCCAAGAAAGAAGAGAAAGTCAT AAGGTCTCTACAGATGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 85, 4: 684} {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!