ID: 1108323990_1108324000

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1108323990 1108324000
Species Human (GRCh38) Human (GRCh38)
Location 13:49312327-49312349 13:49312369-49312391
Sequence CCCTGACTCCCCCAGAGCAACTG TTATGGTAAGTTCCCTATACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 54, 4: 266} {0: 2, 1: 23, 2: 168, 3: 393, 4: 534}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!